rs6949560 chr7:127447704 T>C
- Sequence
acccaacattctctacagtcacac[T/C]cctggggtggagggaagggaaatg
- ASB in cell types
- KMS-11
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 | 1.92 | -2.23 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Esophagus_Mucosa, Nerve_Tibial, Pituitary, Testis