rs695194 chr20:55581211 C>G
- Sequence
ttcaatccagaatgactctgatcc[C/G]tttctaaatatttatcttctcctc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ERR1_HUMAN ARI3A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERR1_HUMAN | n/a | 2.66 | 2.50 | n/a | No Hit | |||
| ARI3A_HUMAN | n/a | 2.73 | 3.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hdl cholesterol, obesity with early age of onset (age >2), refractive error