rs6963635 chr7:83964489 C>T
- Sequence
ttgactgtcatagctgatgatttg[C/T]tctcactaggtttaaagccttcaa
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 0.49 | 1.59 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease (apoe4 positive), diabetic nephropathy in type 2 diabetes mellitus - end stage renal disease, end-stage renal disease (all cause), end-stage renal disease (non-type 2 diabetes mellitus), ldl cholesterol change with statins, type 2 diabetes, type 2 diabetes with or without end stage renal disease, type 2 diabetes, end stage renal disease, years of education