rs696626 chr1:32729828 G>A
- Sequence
aacgtagggagaccctgtgtctac[G/A]aataattagaaaaactagccgggc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293T (embryonic kidney)
- ASB for transcription factors
- ZFX_HUMAN PRDM9_HUMAN ATF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | 1.72 | 0.10 | 1.70 | n/a | No Hit | |||
| PRDM9_HUMAN | 2.20 | n/a | 1.50 | n/a | n/a | |||
| ATF3_HUMAN | 1.67 | -1.56 | 1.33 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), infant head circumference, rheumatoid arthritis, suicide attempts in bipolar disorder (males)