rs6971185 chr7:130298042 A>G
- Sequence
tttaagggtcccctctcaccccgt[A/G]gggaggagtggatcctacatccag
- ASB in cell types
- neural cell K562 (myelogenous leukemia)
- ASB for transcription factors
- SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 1.65 | -1.36 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Lung, Small_Intestine_Terminal_Ileum, Spleen, Thyroid, Whole_Blood