rs6973369 chr7:97118195 A>G
- Sequence
gcaagtcgtcgttaagtgctcaaa[A/G]acctcaggagctttttgtcctttt
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.27 | 0.93 | 1.94 | |||
| K562 (myelogenous leukemia) | 0.34 | 0.46 | 1.41 |
Items per page:
1 – 2 of 2