rs6974649 chr7:131128338 C>A
- Sequence
ataggggtgatatgtgctgaaaag[C/A]tgaaagtagtgtaagcattttttg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.21 | 0.58 | 1.53 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, diastolic blood pressure (dbp), height, ldl cholesterol, ldl cholesterol change with statins, sporadic creutzfeldt-jakob disease, total cholesterol change with statins