rs697763 chr1:228004921 G>C
- Sequence
ggaagcggccggatctcagtgtgt[G/C]tactacccaggtggcacgggcaga
- ASB in cell types
- HEK293T (embryonic kidney) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | -0.48 | 0.94 | 2.17 | |||
| 22RV1 (prostate carcinoma) | -1.32 | 1.71 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (dbp), serum creatinine, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood