rs6977953 chr7:132996666 T>G
- Sequence
cccccaaattgaatcgttacagaa[T/G]tggcaatccttccaagccctgtcg
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.20 | 0.54 | 1.94 | |||
| K562 (myelogenous leukemia) | 0.49 | 0.30 | 1.51 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, neuroticism, obesity with early age of onset (age >2), prostate cancer, rheumatoid arthritis, years of education