rs697847 chr1:226677257 G>A
- Sequence
ccaggatcagggcagaagaacaga[G/A]ctgggacagccttctgattcactg
- ASB in cell types
- breast tumor tissue upper lobe of left lung T47D (invasive ductal carcinoma)
- ASB for transcription factors
- ESR1_HUMAN PRGR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.95 | 0.56 | 1.77 | n/a | No Hit | |||
| PRGR_HUMAN | 0.81 | 1.25 | 1.71 | n/a | No Hit |
Items per page:
1 – 2 of 2