rs6982636 chr8:125467073 G>A
- Sequence
aaatgcctctcctggctgtgggac[G/A]acagttccctccttgggccccagc
- ASB in cell types
- monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.53 | -3.16 | 2.25 | -0.22 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, adiponectin levels, advanced age-related macular degeneration (geographic atrophy), apob assay lipoprotein fraction concentration, apob assay lipoprotein fraction concentration in fasting sample, coronary artery disease (cad), hdl cholesterol, hdl cholesterol (median hdl cholesterol), hdl cholesterol (modeled hdl cholesterol), height, hip bone mineral density (bmd), infant head circumference, ldl cholesterol, ldl cholesterol (female), ldl cholesterol (male), ldl cholesterol small lipoprotein fraction concentration in fasting sample, ldl cholesterol total lipoprotein fraction concentration, ldl cholesterol total lipoprotein fraction concentration in fasting sample, serum creatinine, sporadic creutzfeldt-jakob disease, total cholesterol, total cholesterol change with statins, triglycerides, triglycerides by nmr lipoprotein fraction, triglycerides change with statins, triglycerides lipoprotein fraction, triglycerides, mmol/l