rs6985307 chr8:143846488 C>T
- Sequence
ccgcacaacaactcacatcactca[C/T]tccttttttgttgaaggggtcttt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.25 | 0.76 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), cystatin c in serum, height, ldl cholesterol, lp-pla2 activity, total cholesterol
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid