rs6985646 chr8:109643678 G>A
- Sequence
gccatttcgtggttttaaaaatgc[G/A]taacagtaatattttcacaatgtt
- ASB in cell types
- GM23248 breast tumor tissue
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 1.25 | -0.36 | 1.25 | |||
| breast tumor tissue | 1.37 | n/a | 2.50 |
Items per page:
1 – 2 of 2