rs698815 chr2:44479835 G>T
- Sequence
ttaagttccattttgtatttgaaa[G/T]tgtgtccccaaacaagtattgaca
- ASB in cell types
- K562 (myelogenous leukemia) A549 (lung carcinoma) OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.30 | 0.56 | 2.00 | |||
| A549 (lung carcinoma) | 0.57 | 0.31 | 1.16 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 1.08 | -0.76 | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), hdl cholesterol, height, total cholesterol
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Pituitary, Whole_Blood