rs699512 chr7:43771165 G>A
- Sequence
ccgaaggaagagaccaagatgaat[G/A]cagaggtgagttctttacaaagac
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.66 | -0.15 | 1.98 | |||
| HEK293 (embryonic kidney) | 0.77 | -0.25 | 1.62 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood