rs699576 chr12:62901079 G>A
- Sequence
gtcatccgcctctatttccatgta[G/A]ccggatacatttttgcatcatgta
- ASB in cell types
- HEK293 (embryonic kidney) embryonic kidney
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | -1.34 | 1.84 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), irritible bowel syndrome, parkinsons disease, partial epilepsy, refractive error, serum creatinine, sporadic creutzfeldt-jakob disease
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Muscle_Skeletal, Pituitary, Skin_Sun_Exposed_Lower_leg