rs700943 chr2:6986438 G>A
- Sequence
cttgaaggagacagccattgtgcc[G/A]ggcctgcccccttgttgagctggc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | 1.29 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, birth weight, comorbid depressive syndrome and alcohol dependence, diabetic retinopathy in type 2 diabetes mellitus, primary rhegmatogenous retinal detachment, sporadic creutzfeldt-jakob disease, triglycerides change with statins