rs701224 chr1:233631262 T>A
- Sequence
tttccctttgccaccaggtgcggg[T/A]ttctgacaacatcaagatatgaaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MTG16_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MTG16_HUMAN | 2.28 | n/a | 4.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration (geographic atrophy), bipolar disorder, irritible bowel syndrome, ldl cholesterol, waist hip ratio