rs7031406 chr9:6932013 A>G
- Sequence
gtgaggacagaaaaagtgtcagtg[A/G]ttcatcagagaagtgagctcattt
- ASB in cell types
- coronary artery smooth muscle
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 4.15 | n/a | 6.00 | -4.86 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP bipolar disorder, body mass index (bmi), infant head circumference, ldl cholesterol, rheumatoid arthritis