rs7032782 chr9:133479446 G>T
- Sequence
actcgctcccgcggggtggaaacc[G/T]aggcccagagaggcgaagccgagc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFX_HUMAN | -2.98 | 2.10 | 1.50 | 0.77 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
