rs7034992 chr9:122264385 G>A
- Sequence
gcaacaatcctttagactaccaga[G/A]ttcacaaaacgcggttacatttgt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.11 | 0.62 | 1.70 | |||
| GM12878 (female B-cells) | 0.61 | 0.53 | 1.27 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), maternal transmission distortion, neuroblastoma (brain cancer), partial epilepsy, paternal transmission distortion, tardive dyskinesia, transmission distortion