rs704771 chr1:39695341 A>G
- Sequence
agagagtgagatcaccagagttgg[A/G]ttccttccttttatgctattggct
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.06 | 0.55 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, hip bone mineral density (bmd), homa-b, ldl cholesterol, sporadic creutzfeldt-jakob disease
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Pancreas, Pituitary, Whole_Blood