rs705506 chr19:38112097 C>A
- Sequence
ccatgcgtccgcacatgcacacac[C/A]tacatgcacacacatacatgcaca
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.49 | 0.97 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.81 | -0.53 | 4.54 |
Items per page:
1 – 2 of 2