rs706879 chr6:111710108 C>T
- Sequence
attaaaaataacaatacccagctc[C/T]tccccctccaccctctcccgccca
- ASB in cell types
- foreskin keratinocyte breast epithelial cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.44 | n/a | 2.50 | |||
| breast epithelial cells | -1.17 | 1.00 | 1.33 |
Items per page:
1 – 2 of 2