rs706931 chr6:110815399 T>C
- Sequence
caggcacccccagtcccgcctccc[T/C]ccttcatttccttgttttggaacc
- ASB in cell types
- fetal bone marrow-derived mononuclear cells thymus-derived CD34- cells breast tumor tissue
- ASB for transcription factors
- KMT2A_HUMAN ESR1_HUMAN BC11B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | -3.39 | 2.54 | 1.50 | n/a | n/a | |||
| ESR1_HUMAN | n/a | 2.55 | 2.50 | n/a | No Hit | |||
| BC11B_HUMAN | 2.09 | -0.19 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid