rs7076658 chr10:71570050 C>T
- Sequence
gagcagctgggactacagatgcat[C/T]gttgaggttttatacaatgaaatt
- ASB in cell types
- foreskin keratinocyte A549 (lung carcinoma)
- ASB for transcription factors
- SMC3_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | -0.47 | 0.93 | 2.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.67 | 0.66 | 1.66 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, bipolar disorder, body mass index (bmi), obesity with early age of onset (age >2), serum creatinine, triglycerides