rs707827 chr6:15327269 G>A
- Sequence
tttttgttttcttttttaagagac[G/A]gtcttgccctgtcacccaggttgg
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.90 | -0.67 | 3.01 | |||
| foreskin keratinocyte | -0.99 | 1.71 | 2.17 |
Items per page:
1 – 2 of 2