rs7085532 chr10:113099704 G>A
- Sequence
tgaacagtagatgatgcttctgcc[G/A]tgcgttttgctggggaaggtaaca
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | -0.97 | 1.61 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), ldl cholesterol, obesity with early age of onset (age >2), oral cancer in patients with long term tobacco chewing habit, salmonella-induced pyroptosis, schizophrenia, serum creatinine, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio