rs708689 chr19:5823323 A>C
- Sequence
cccagctactcggggggctgaggc[A/C]ggagaatcgcttgaacccgggagg
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PRDM1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRDM1_HUMAN | 2.13 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Heart_Atrial_Appendage, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis