rs709024 chr20:4221337 C>T
- Sequence
acctgagtccagcagggggcccca[C/T]tacttttcacctttcaagggctcc
- ASB in cell types
- MM1.S (plasma cell myeloma) T47D (invasive ductal carcinoma) foreskin keratinocyte spleen
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MM1.S (plasma cell myeloma) | -1.60 | 2.15 | 1.67 | |||
| T47D (invasive ductal carcinoma) | -0.47 | 1.41 | 1.56 | |||
| foreskin keratinocyte | 0.45 | n/a | 2.33 | |||
| spleen | -1.43 | 1.71 | 1.00 | |||
| mammary epithelial cells | -1.97 | 1.89 | 1.33 |
Items per page:
1 – 5 of 5