rs7094181 chr10:59865402 T>C
- Sequence
agagatgactgccaaatccaaggc[T/C]cctcccaccctttcccggcaaggt
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.43 | n/a | 2.67 | |||
| K562 (myelogenous leukemia) | 0.46 | 0.28 | 1.34 | |||
| GM12878 (female B-cells) | 0.55 | 0.29 | 1.29 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Muscle_Skeletal, Testis