rs709520 chr3:107895076 T>C
- Sequence
aaagcattttccctaacatatatt[T/C]ctgttggggaatatagtacggaca
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- MAFK_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAFK_HUMAN | -0.54 | 1.43 | 1.56 | n/a | No Hit |
Items per page:
1 – 1 of 1