rs709844 chr8:17013027 A>C
- Sequence
ctctagtcataaagccatgcactg[A/C]aagaacattctctgccgcagaggg
- ASB in cell types
- SK-N-SH (neuroblastoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | 1.35 | -1.43 | 1.33 | |||
| HepG2 (hepatoblastoma) | -0.22 | 1.08 | 1.29 |
Items per page:
1 – 2 of 2