rs710595 chr3:190118162 G>A
- Sequence
gaggggaaatgactgacaaatgct[G/A]acattaacagtgaagcaagcagaa
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- IKZF2_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | -1.78 | 1.90 | 1.33 | n/a | n/a | |||
| IKZF1_HUMAN | -1.72 | 1.65 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als) age of onset, homa-b, hypertension (early onset hypertension), infant head circumference, years of education