rs7107692 chr11:128158158 G>A
- Sequence
cacccattcattagacctctgagg[G/A]cacagagatgttttcaatcattgg
- ASB in cell types
- PC9 (lung adenocarcinoma) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | 0.88 | -0.48 | 1.33 | |||
| epidermal keratinocytes | 1.66 | -1.26 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, ldl cholesterol change with statins, rheumatoid arthritis, total cholesterol change with statins