rs711355 chr15:29901265 T>C
- Sequence
cacgacatcctgaagatcgcaatg[T/C]gtacacagtttcttgtaaatattc
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 2.03 | -0.99 | 1.50 | -4.94 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP ldl cholesterol change with statins, patient global impression scale of severity with risperidone treatment of schizophrenia, simpson-angus scale, total cholesterol, total cholesterol change with statins, treatment outcomes for selective serotonin reuptake inhibitors (ssris) - response at last visit