rs7116758 chr11:65802934 G>A
- Sequence
tcaaggtcacacggtgagcaagtg[G/A]tgaagctgggctctgacctgacgc
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- BHE40_HUMAN MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BHE40_HUMAN | 1.80 | -1.59 | 1.33 | n/a | No Hit | |||
| MEF2B_HUMAN | 1.64 | -1.89 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, birth weight, hdl cholesterol, ldl cholesterol, systolic blood pressure (sbp), total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood