rs7119797 chr11:62398763 C>T
- Sequence
tctctgtcaggcctcacaatcttc[C/T]gggccatctttgttgtcttatctc
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- SMCA4_HUMAN ESR1_HUMAN ZEB2_HUMAN HTF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | -0.63 | 2.16 | 2.00 | n/a | n/a | |||
| ESR1_HUMAN | 0.15 | 0.85 | 1.43 | n/a | No Hit | |||
| ZEB2_HUMAN | -0.73 | 1.95 | 2.00 | n/a | n/a | |||
| HTF4_HUMAN | -1.28 | 1.62 | 2.00 | n/a | No Hit | |||
| MNT_HUMAN | -0.98 | 1.52 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, cystatin c in serum, hip osteoarthritis, hip osteoarthritis (females), knee osteoarthritis (females), lp-pla2 activity, lp-pla2 mass, osteoarthritis (females), systolic blood pressure (sbp)
GTEx eQTL Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid