rs7120121 chr11:128157818 T>G
- Sequence
attccaattgttggtttaggaaaa[T/G]tccagcaggtggagctgtaacagc
- ASB in cell types
- PC9 (lung adenocarcinoma) T47D (invasive ductal carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | 0.94 | -1.33 | 1.33 | |||
| T47D (invasive ductal carcinoma) | -0.12 | 1.08 | 1.92 | |||
| foreskin keratinocyte | 0.44 | n/a | 2.83 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, ldl cholesterol, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins