rs712328 chr14:36771320 G>T
- Sequence
acaaaataaatcactgatttaatc[G/T]tatttttgcaattgtcatttttgg
- ASB in cell types
- HEK293 (embryonic kidney) ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.17 | 0.53 | 1.65 | |||
| ZR-75-1 (invasive ductal carcinoma) | -0.42 | 1.41 | 2.00 |
Items per page:
1 – 2 of 2