rs7125151 chr11:93543976 G>C
- Sequence
gcgcagctcagcataaataaatga[G/C]attcacaattccccacctcggacc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.20 | 0.97 | 2.00 | |||
| GM12878 (female B-cells) | 0.60 | 0.08 | 1.28 |
Items per page:
1 – 2 of 2