rs71260490 chr21:8991779 C>T
- Sequence
ctttcactgtgttactccccagtc[C/T]ctaccacgtgtttatctccaaacc
- ASB in cell types
- T47D (invasive ductal carcinoma) A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.39 | 0.09 | 2.00 | |||
| A549 (lung carcinoma) | 0.76 | 0.05 | 1.71 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.15 | 0.56 | 2.33 |
Items per page:
1 – 3 of 3