rs7128352 chr11:88354189 C>T
- Sequence
taaaagggtacagaaacattacca[C/T]aagttgaactttctagttgcttag
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.71 | 0.45 | 1.28 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-ir, ldl cholesterol change with statins, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), premature ovarian failure, serum creatinine, total cholesterol
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Heart_Left_Ventricle, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood