rs7130017 chr11:30310847 C>T
- Sequence
cactcaagttacaaaccattgtct[C/T]agttcagaaagtggaactgccaag
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.57 | 0.35 | 1.34 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pituitary, Spleen, Testis, Thyroid, Whole_Blood