rs713130 chr18:70293358 A>G
- Sequence
ccccaacagccccacagagagaca[A/G]ctgtcactgcctgtagagctatga
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts K562 (myelogenous leukemia)
- ASB for transcription factors
- GATA1_HUMAN MEIS2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 2.15 | -0.27 | 1.44 | n/a | No Hit | |||
| MEIS2_HUMAN | -2.23 | 1.99 | 1.50 | 0.81 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
