rs713449 chr14:60562366 C>G
- Sequence
ccacctcgtgtgcaaaagcgtttt[C/G]ttttgtttcctcgagaaccactag
- ASB in cell types
- erythroid cells MCF7 (Invasive ductal breast carcinoma) gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | n/a | 2.44 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.23 | 0.66 | 1.54 | |||
| gastroesophageal sphincter | 1.34 | -0.20 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP height, infant head circumference, obesity with early age of onset (age >2), rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Sun_Exposed_Lower_leg, Thyroid