rs713875 chr22:30196498 C>G
- Sequence
cgtcatcaccatcgcggtggccag[C/G]gtcagcgtttgacaaaggaagtac
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) cranial neural crest cells
- ASB for transcription factors
- COT1_HUMAN ZSCA4_HUMAN PKNX1_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | 0.06 | 2.62 | 1.92 | 7.08 | Concordant | |||
| ZSCA4_HUMAN | -1.91 | 2.14 | 2.00 | n/a | n/a | |||
| PKNX1_HUMAN | 1.74 | -1.53 | 1.33 | n/a | No Hit | |||
| CREB1_HUMAN | 1.08 | -0.37 | 1.44 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP crohns disease, hdl cholesterol, lung cancer, rheumatoid arthritis, total cholesterol change with statins, ulcerative colitis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Caudate_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid