rs713939 chr22:37330619 T>C
- Sequence
ctcattccccttgagtctgcagct[T/C]gggcaatcaatcggtcgccatgga
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) epithelial cell of prostate HEK293 (embryonic kidney) PC9 (lung adenocarcinoma)
- ASB for transcription factors
- RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | 1.26 | n/a | 1.42 | -0.42 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration, hdl cholesterol, obesity with early age of onset (age >2)