rs7141210 chr14:100716133 T>C
- Sequence
tccctcactctttctttcttggag[T/C]ctgggattcctctctgtttctata
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.13 | 0.65 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, cystatin c in serum, diastolic blood pressure (dbp), hdl cholesterol, ldl cholesterol, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Testis, Whole_Blood