rs7145877 chr14:23547157 A>G
- Sequence
agatacctctggagtctttcaaca[A/G]tggagagtcagatgtcaaggccat
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.84 | -0.05 | 1.71 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, barnes akathisia rating scale, hdl cholesterol, homa-b, longstanding arthritis, tardive dyskinesia, triglycerides, variant creutzfeldt-jakob disease, years of education